Florian Cramer on Sun, 17 Nov 2002 18:17:50 +0100 (CET)


[Date Prev] [Date Next] [Thread Prev] [Thread Next] [Date Index] [Thread Index]

<nettime> unstable digest vol 21


Date:         Wed, 13 Nov 2002 08:13:23 -0800
From: Jeffrey Jullich <jeffreyjullich@YAHOO.COM>
Subject: Stephen & Marian Guei

--0-328886672-1037204003=:92769
Content-Disposition: inline


Note: forwarded message attached.


__________________________________________________
Do you Yahoo!?
U2 on LAUNCH - Exclusive greatest hits videos
http://launch.yahoo.com/u2

X-Apparently-To: jeffreyjullich@yahoo.com via 66.218.78.188; 13 Nov 2002 07:28:31 -0800 (PST)
X-Track: 0: 100
Return-Path: <stephen.guei@caramail.com>
Received: from 213.193.13.93  (EHLO mail2.caramail.com) (213.193.13.93)
  by mta616.mail.yahoo.com with SMTP; 13 Nov 2002 07:28:30 -0800 (PST)
Received: from caramail.com (www30.caramail.com [213.193.13.40])
        by mail2.caramail.com (Postfix) with SMTP
        id 0E181CABF; Wed, 13 Nov 2002 16:28:27 +0100 (MET)
From: stephen guei <stephen.guei@caramail.com>
To: stephen.guei@caramail.com
X-Mailer: Caramail - www.caramail.com
X-Originating-IP: [64.110.146.28]
Mime-Version: 1.0
Subject: awaiting for your reply
Date: Wed, 13 Nov 2002 16:28:16 GMT+1
Content-Type: multipart/mixed; boundary="=_NextPart_Caramail_0189351037201296_ID"
Content-Length: 1428

This message is in MIME format. Since your mail reader does not understand
this format, some or all of this message may not be legible.

Dear Friend,

This is strictly confidential. It is coming to you
directly
from Abidjan, Ivory Coast West Africa- a nation and sub-
region in turmoil.

 You are surely aware of the on-going rebellion here in my
country for quite some time now. The xenophobic,inept and
incompetent regime of LAURANT GBAGBO faced yet another
bloody coup detat middle of September in which the FPI-led
government crudely assasinated my fathe,General Robert
GUEI,my mother and hordes of bodyguards accusing the
former
head of state maliciously of being behind the insurrection
which has but blossomed northwards.

I had been away in Accra, Ghana ,doing my higher education
during the military revolt which claimed equally the life
of the interior minister and hundreds of others. My
absence
at home was what saved my young life.

 Few days ago however still smarting from shock and trauma
emanating from losing both dad and mum I sneaked into the
city to take possession of my late father's secret
financial fortune left behind in the West African
International Bank known here in French as BIAOCI.
Ever since I have been in constant contact with the bank's
international operations division's director who has
assured me of the safety of the fund(totalling 12.5
million
euros).

He has however underscored the urgent need for the fund to
be transfered out through a third party as soon as
possible. The paramount importance of lifting this fund
outside this shore cannot be over-emphasized at this
exceptional moment in time.

Therefore, should you be interested in helping me out,
please feel free and write me back via the net. Everything
is open for negotiation in this respect. Presently I am
living underground here for fear of being kidnapped or
killed by prowling secret agent of the state.

 So I must leave for your country or elsewhere as soon as
this transaction is sealed, done and completed. I shall be
glad indeed if you can act immediately. Thanks and God
bless.

Yours sorrowfully,
stephen and marian Guei
_________________________________________________________
Gagne une PS2 ! Envoie un SMS avec le code PS au 61166
(0,35€ Hors co=FBt du SMS)


Date:         Mon, 11 Nov 2002 23:08:21 -0500
From: Alan Sondheim <sondheim@PANIX.COM>
Subject: everyone

everyone


Bruce Carol Carolyn Charles E.K.Huckaby Funkhouser Gerstein Gillam Ian J.
Kelk Marjorie Monty Peter Radhika Theresa Thomas WRYTING-L \ Charles
experimentaltvcenter.org ian.kelk mezflesque.exe net.wurk][.who][ &
'Christopher Edward ALR Alan Andy Annie Architext Cary Chris Dan Deb
E-mail E-mail Ellen Fritz Gary Katie Laurie Leslie_Thornton Mark McKenzie
Mike Nile Peter ROBERT US-LIHI a.k.a adagrace9 anafrigon c cinema complit
dan dripdrop22 foofwa ijerry jen joanna joel mzpm peter simon sue.thomas
3rdBed 7-11 :  0vira 106271.223 3sticks AOL-LIST-OWNERS Funkhouser
ISMurray Ian.Kelk J_WOODSON JohanMeskensCS2 KJOHNSON Mariannede_graaf
Mark.Amerika MuratNN POETICS Peter_G_Kelk.KELK RWITHERS WRYTING-L a.little
abroeck alexis amerika anabasis anastasios anastasios.kozaitis andyo
anniea architext arpadt atlassheppard b.watten barrysmylie bernstei
bgehring bindi_love birringer.1 bradleybayonet brantp brotman bruce
buckleyr burkew caitlin caitlinm calexand cantsin catherine.gillam
cguertin chrisdrury christys cjr90210 ckeep clkpoet couperj cthyd
cyberculture damianc damon001 dan_sondheim daveliza db62 ddelgado deb
decklin dilillo djeng domfox dsondhei dtv duncanr e.milne ecodub
ecsatyricon edz ekhuckaby electromediascope emgarrison etc evalle film6000
foofwa fractal frazerv galesnow gdstereo geert geraldfilm ggatza giardia
glazier gmguddi gniewna gothwalk gquasha groovdigit guernsey gwiebke
h.whitehead hankru harveyb horvitz horvitzr human hypobololemaioi i2eye
ian.kelk info integer irwin.gerstein ivan janedoe janez.strehovec jdavis
jen jh3 jim jlehmus joe.amato johngr joris joseph_nechvatal jtley
julia.kelk k.zervos katies kenworth kingd kkretz4art kolasins kozl0023
kristin ksoden lakey.teasdale laporta laporta.interport lawrence.upton
lcubbison liutpran lizral llacook luesebr1 maguirew marblehead margaret
martha martinej marton marylynn mattsamet mckenziewark men2 mesper
mezandwalt mfwj mgomez mgurst mi_ga mike mint77 mister_furiously monty
morgand morrigan msotor01 mtxmetz murray mw35 mzpm nativeagent neekaa80
netwurker nile nillo oga olseng orishai owidnazo p.sidjanin patrick peter
poetics pollet protagonistus r.mulvale r.strasser raintaxi rakaise reality
reiner.s reith roitman rumsong runran ruthnow sacred_grove saizy samills
schuppm sghaly shemurph2001 simon.mills sjaugu solipsis sondheim stalder
stelarc stephan steven.meinking strickla sue.thomas sukenick talan
tennessee threads tom967 torresm trevor.pull tyler.stallings vest27
vfrenkel vstandley wanda.interport wander warnell wattsb weinstone
weishaus white-b wolf wolfgangsta zeropoet zeug =?ISO-8859-1?Q?=A4?=
=?iso-8859-1?Q?Glazier=2C_Loss_Peque=F1o?= =?iso-8859-1?Q?Peque=F1o?= A.
ACSU.BUFFALO.EDU Metropole ADM.NJIT.EDU ANASTASIOS AOL AOL.COM ARTvB
Abeles Abrahams Ad Adams Administration Again Agnihotri Ahwesh Alexander
Alexander' Alexis Amanda Amato America Amerika Anastasios And Andreas
Andree Andrews Angela Ann ArchJoanna Arpad Atlas Auler Avillez Awentler
AzurCarter Azure BA BATIPATO BH BRITISHLIBRARY.NET uptonlawrence Barbara
Barbara_Simcoe/CFA/UNO/UNEBR Barrett Barry Beatrice Beaubien Belinda
Belinda.Barnet Berk Bernstein Beth Bill Birringer Bo Bob BobAuler Bowes
Bowne Bradley Brant Brian Broeckmann Brown Bruce Buckley Buffalo Bugaj
Burke BushPieter C C. CCCHAP129 CF CS2 CT/HYD-Jayadev Caitlin Calishain
Carol Carolyn Carter Catherine Charles Cheatham Cheng Chris Chris
Christopher Christy Chromatic ChromaticSpaceAndWorld.com Jayadev Clive
Colorado.EDU cwa Connie ConnieBostic Couper Courtney Cramer Cubbison
Curating Cyb Cyberculture Cyberdiva DH DK DS DSchell DScott2706 Dad Dahlia
Dallas Damian Damian Damon Dan Daniels Danna Davdhess Dave David Davis De
Deb Decklin Del Delgado Denise DiLillo Disciplines Disciplines Diwakar
Dixon Dominic Dougie Drury Duagn Duffy Dugan Duka Duncan E. E.K.Huckaby
EChuse EK Earthlink.net Ed Edward Elaine ElizabethGold Ellen Emily Esper
Esta Eve Evelyn Everard Experimental FL Fido Finnegan-Suler Florian
Fogarty Foofwa Fort Forum Foster Fox Fractal Frank Frazer Fred Frenkel
Fridiric Furtherfield G GU Gabriel Gafner Gajjala Gale Ganick Gary Gatza
Geert Gehring Geoff Geofferey Geoffrey George Gerald Ghaly Giuseppe
Glazier Glulmer Gomez Goodman Gordon Gothwalker Gregory Grohol Gudding
Guertin Guiseppe Gurstein Guttenplan Gwen H H. HS Halifax Hank Haralambos
Hartley Harvey Harvey Hay Helen Herman Hernandez Herron Holmes Holstein
Home#447-8106 Horvitz Howard HronnAxels Hunter Ian Iank Iannicelli
ImitationPoetics Innocent Irwin Ivan J. JDORTIZ JOHNSON JON JONES JR Jacek
Jacques Janez Jarnett JauguDenis Jeff Jennifer Jerry Jillian Jim Joe Johan
Johannes John Jon Jonathan Jones Jordan Joris Joseph Juan Judith Judy
Jukka JuliStein Julie KAbeles100 KENT KOZAITIS Kaiser Karen Kate Kathy
Katie Keep Keith KeithBklyn Kelk Kelly Kenji Kent Kim King Kirby
Kirschenbaum Kndanis Knoebel Kozaitis Kozlowicz Kraus Kretz Kristin L L.
LISTSERV.AOL.COM Decklin LISTSERV.UTORONTO.CA Tennessee LY64203 LaPorta
Lakey Lanny Laramee Lassiter Lattanzi Laura Lawrence Lee Lehmus Lehmus
Leo7of9 Leslie Levenson Levenson Ley Liberman LibertyInternational.com
Julia Lisa Lissa List Little Liza London Lopez Lori Loss Luesebrink
Luesebrink Lynn M. MAILBOX.GU.EDU.AU tom MP MSPOSTER Magee Maguire Mairead
Mamatas Manny Manuel Margaret Mari Maria Marjorie Mark Marley Marshall
Marstonmj Martim Martin Martinez Mary Matt McKenzie Mcglynn Meinking
Melzack Memmott Meskens Metz Michael Michael.Carter Miekal Miguel
Miguel1075 Millennium Milne Mirta Mitch Mitchell Mom Monica Monika Monty
Morgan Muckraker Mulvale Murat Murphy Murray Murray Myers N. Nada Nascad
Nech Nechvatal Nemet-Nejat New Newmedia Nick Nicole Niss Nmherman Norman
OPiSu Observations Olsen Online Ontario Oram Ostrow Owners'
P[urrsonal]A[reah]N[etwurker] Pat Patrick Patrick's Peggy Penfold
Peppermint Peter PeterM3369 Phipps Pier Pierre Pip Poetics Pollet Pope
Poster Potes Predrag PsyD Pull Quasha R RC RCleaners RF Rain Rebecca
Reiner Reith Rice Richard Richardson Rikerj Robert Robert_Kolker Robin
Rogers Roitman Ron Rose Rosen Rudolph Rumson RyanSheila S. SAM SCI
SEANET.COM faculty SVAak Salus Salus Salwa Sam Samet Sanborn Sandy Sanford
Schaap Schell Schupp Senft Senft Serra Shakuhachi Sheffield Sheppard
Sheppard\ Shiel Sideratos Sidjanin Simcoe Simon Siratori Smassoni Smith
Smylie Soden Sondheim Southern Staehle Stahlman Stalder Stallings Stefan
Stefanp Steinhuber Stephan Steve Steven Strasser Strehovec Strickland
Sub^2*P Sue Sukenick Sullivan Sylvester TB TC.UMN.EDU Talan Tara Taxi
Teasdale Ted Theory Tina Tom Tori Torres Tosh Trevor Tuttle Tyler UCI.EDU
UVic.CA Uli Ulmer Unna Upton Valle Vera Vernon Victoria Vladimir
WANTREE.COM.AU WAYNE.EDU WITHERS WOODSON WRYTING-L Wanda Wands Wark
Warnell Watten Watts Weinstone Weishaus Weiss Whitehead Wiebke Wilson
Withers Wolf Wolfgang Wolsak Woodson Writing Xios2000Ny YAHOO.COM Yerby
Zimmermann Zweig _arc.hive_ aND abeles across acsu.buffalo.edu
acsu.buffalo.edu Laurie against agoron.com Andy ahunt03 airmail.net
alexandria.lib.utah.edu Bryan altx.com anabasis anart.no and andrew.devore
andyo angelfire.com anu.edu.au aol.com aol.com Mike aol.com nick aol.com
arc arenal artador artforum arthist.usyd.edu.au artistStelarc
artmetropole.org artsci.wustl.edu at att.net aya.yale.edu trace
azurecarter bassmuseum.org bbs.thing.net bc bear3843 bellsouth.net
bellsouth.net berklynn beth bgnet.bgsu.edu bigfoot.com bindi_love
bitstream.net bk.tudelft.nl block booglit brian brown.edu btopenworld.com
bugaj.com bway.net c cable.A2000.nl cadvision.com calumet carlos cary
cats.ucsc.edu cb cc chatsubo.com christy cicalafilmworks.com
city.london.on.ca ck clarendon-ins.com class cleo.murdoch.edu.au clive
cmhcsys.com cmod cnsunix.albany.edu colorado.edu columbia.edu columbia.edu
compuserve.com compuserve.com Salwa conferenceStephanie cornell.edu
cox.net cs.com csam.com csulb.edu cute_227 cybermind d'Imobilite
d4.dion.ne.jp daemen.edu damianc dan_sondheim debris.org.uk denis
destroythe.net dial.pipex.com dial.pipex.com dingoblue.net.au dloprieno
dnai.com dock.net dominic dreed drifab.com dukaduka e-conf earthlink.net
earthlink.net earthlink.net ec echeng4 echonyc.com echonyc.com edbowes
editor edz egroups.com electronetwork.org elmyra.bsn.com email.msn.com
email.msn.com emgarrison emory.edu epix.net epix.net ern_perez esondheim
etc ews excite.com experimentaltvcenter.org experimentaltvcenter.org suler
ez ezweig f f fac.howard.edu famobrien5 fdt.net feliz1892 fineartforum.org
fis.utoronto.ca fiu.edu fiu.edu fiu.edu family foofwa footworks.org
forwardface.com fp3d.com fractal fragment.nl franklinfurnace.org
franklinfurnace.org franklinfurnace.org Christine from furball.bsn.com
furtherfield.org gabe gagaku galactica.it integer gary.wiebke geert
geoffrey globalserve.net globility.com gnv.fdt.net Saul
gpu.srv.ualberta.ca Randy grievance guernsey guest.arnes.si jabes gwen
hawaii.rr.com hccstudent.highland.cc.il.us hd2.dot.net.in hell.com
hevanet.com home.com horvitz hotkey.net.au Cary hotmail.com hotmail.com
hotmail.com building hotmail.com e hotmail.com hotmail.com Amerika
hphoward.demon.co.uk hs.utc.com cath http://plexus.org/newobsMillie
i.rigau ian.kelk icann.org igc.org ihug.co.nz iinet.net.au ilstu.edu
imitation iname.com indifference.f9.co.uk info innotts.co.uk interport.net
t investorama.com daniel is2.nyu.edu is6.nyu.edu Joel isone.com
ivanpope.com ix.netcom.com ix.netcom.com ix.netcom.com Kevin jacek jacques
jazkat13 jedimatrix99 jen jerry.everard jes20 jfr10 jjsamuel jmarshal joel
john jon jonnes jps.net jr23 julian juno.com jw jwoodson jyerby kelk.com
kelk.com media kelk.com kelly kenworth king kle300087 komninos ks l lacook
lakey lastrella lawsuits lcubbiso lesliethornton lewis linuxchix.org jen
lisa lisatuttle lissa listbot.com listserv listserv.acsu.buffalo.edu
listserv.aol.com listserv.unc.edu lit.kyushu-u.ac.jp lm.va.com.au lovink
lperez lpita lt lusitania mIEKAL mac.com mafe1602 magazine mail
mail.island.net mail.ivillage.com mail.ljudmila.org mail.mcgill.ca
mail.slc.edu sub mailhost.sva.edu maine.edu mamitajr mari maria markgold2
martha marton math.ukans.edu mb255 mbox.vol.cz mbox.vol.cz mcglynn
megnbill melzack memlane.com memmott.org mesper mez mg mi_ga
miami-airport.com miamialli mick miekal miensminger mikemetz mile12
millenniumfilm.org mills mindspring.com mindspring.com mindspring.com pk
mishi103 mitec.net mjlamas mloomis mmc189 mmjbutterfly mobile-swami.co.uk
mobile-swami.co.uk net moby moby-group moc993 mom monika morrigan mrzero
multiverse.com mwt.net nada neekaa80 nervm.nerdc.ufl.edu netartefact.de
netspace.org nettime nettime-l new-poetry newobs newobservations.org
newyorkmag.com nicolepeyrafitte.com nile nirvanet.net noel2.pd.org nonce
now nowdigthis.com pan np nrma.com.au ns.sympatico.ca ntu.ac.uk ntu.ac.uk
ntu.ac.uk loss ny.com nyc.rr.com nyu.edu o-o.lt ol.com.au olsen
ompez_les_yeux omri.cz on onelist.com onone ora.com orishai osu.edu Bowes
overtone ozemail.com.au pacifier.com panda627 panix.com panix.com paper
pce.net pcourtney pdx.edu g peggy peppermint peter petitepita1 pgkelk
pgrad.unimelb.edu.au pinamonti.com pk pkelk pop.qn.net pote providence
proximate.org psy psy-internet ptdprolog.net r.l. rabecker.com racores.com
radford.edu radhik radhika ram79108 randy rcn.com rcn.com reading
readmemag red-bean.com reiner requiem restlessculture.net deb rh rigau
rjanno01 rmetcalfe robert rocketmail.com rogers.com rotman ruby.ora.com
runet.edu jerry ruth rw ryan.whyte saiz sandy sandyweiss sanmiguel
sbcglobal.net Sue sd seiche serra shakuhachi.com jennifer shann001
sharjah.ac.ae shaw.ca simon simon.mills sionna13 skunky49 so5 solipsis
sondheim sorenson southern spar spot.colorado.edu sprintmail.com standley
starflung.com stationhill.org stefan steinhuber.com steven
stevenmeinking.net stewartga strasser strawgrrl stuff subsubpoetics suler
sva.edu sva.edu sympatico.ca syndicate tao.agoron.com tati_1127 tc.umn.edu
telus.net the the-beach.net theeastvillageeye.com thing.net thing.net Drew
thing.net Felix thingist timothyj_aka_dj_yt tina tom tonefield
tonywhitfield2000 tosh tosh3 tr trAceWark transmediale.de tts.fi u
ulassite unix unm.edu unomail.unomaha.edu usdoj.gov utoronto.ca
utoronto.ca uwo.ca uws.edu.au va.com.au va.pubnix.com vcn.bc.ca vcn.bc.ca
verizon.net verizon.net Neil vif.com vincent vispo.com voicenet.com
waitrose.com Zimmermann webartery webleicester.co.uk wanda webtv.net
weishaus weiss well.com whyte widmer wifeMartha wiz.cath.vt.edu
wollongong.starway.net.au worldnet.att.net www.god-emil.dk
www.xcelnets.comTheresa xmetz.com sm xs4all.nl xterna-net.de yahoo.ca
yahoo.ca yahoo.com yahoo.com yahoo.com Wands yesy yolie yorku.ca zacha.org
zdnetonebox.com Bobby zedat.fu-berlin.de zervos zlorac
zorro.cecer.army.mil zummer


===




Date: Sun, 10 Nov 2002 16:35:24 +0100
From: "+   lo_y.  +" <loy@myrealbox.com>
Subject: Re: RE: |   || " || 10-11-2002-13:36 |_| 245516 4"


------------=_1036942460-655-147

At 15:08 10/11/02 +0100, claudia wrote:

>>( " http://medg.lcs.mit.edu/people/psz/LCS-75/old-new.jpg " )
>>
>>( " jmcs2 told me cantsin is a little curious " )
>
>perhaps cantsin refuses to believe in a 'real' mystery ? (  for 
>understandable reasons )
>

lo_y = "real"
lo_y = NOT(authentic)
lo_y = NOT(a mystery)
lo_y = NOT(understandable)
lo_y = NOT (%false)

( " some ppl know too much " )

claudia

>http://www.google.com/search?q=%22Claudia+Westermann%22+-saron+-test+-lhrowver+-erzbistum+-thedinghausen+-lvr+-bildungsmedien+-applaus+-guess_all_other_exclusions&filter=0

" Did you mean:"Claudia Westermann" -saron -test -lhrowver -erzbistum 
-thedinghausen -lvr -bildungsmedien <bold>-applause</> - 
guess_all_other_exclusions

ezaic - [ Translate this page ] "


( " black pages and black cursors don't go well together " )



>and
>eternally we return to every crossing
>
>now and now again there is hope

????????


gruesse,

lo_y


>

------------------------------------------------------------
--------------lo--------------------------------------------
                       -
-----------------------y------------------------------------
------------------------------------------------------------
-------------PTRz:
http://rhizome.org/object.rhiz?5852
http://trace.ntu.ac.uk/incubation/gallery.cfm
www.muse-apprentice-guild.com
http://www.krikri.be/poeuk.html
http://www.google.com/search?q=lo_y
------------------------------------------------------------
------------------------------------------------------------


------------=_1036942460-655-147
Content-Disposition: inline; filename="message.footer"




From: "Johan Meskens CS2 jmcs2" <JohanMeskensCS2@chromaticspaceandworld.com>
Subject: Re: REnewed: ||   || " || 10-11-2002-13:36 |_| 245516 4" || red|||||blue||||||yellow||||||yellow|||||white||||||      | 'red ~" || - |
Date: Sun, 10 Nov 2002 16:52:10 +0100

" we repeat pseudonyms ( dixit clj )

= = a pseudonym of pseudonym
cantsin = a pseudonym of unendlich
cantsin = a pseudonym of no
has = a pseudonym of curious
unendlich = a pseudonym of a
lo_y = a pseudonym of is
lo_y = a pseudonym of means
the = a pseudonym of a
has = a pseudonym of lo_y
has = a pseudonym of jmcs2
and = a pseudonym of no
jmcs2 = a pseudonym of meanings
past = a pseudonym of has
has = a pseudonym of pseudonym
little = a pseudonym of unendlich
mens = a pseudonym of =
a = a pseudonym of past
jmcs2 = a pseudonym of means
= = a pseudonym of mens
jmcs2 = a pseudonym of a
curious = a pseudonym of past
meaning = a pseudonym of pseudonym
meaning = a pseudonym of a
several = a pseudonym of meaning
several = a pseudonym of means
lo_y = a pseudonym of viel
told = a pseudonym of unendlich
a = a pseudonym of is
of = a pseudonym of =
meaning = a pseudonym of has
a = a pseudonym of past
told = a pseudonym of has
the = a pseudonym of is
 = a pseudonym of a
and = a pseudonym of has
a = a pseudonym of =
of = a pseudonym of has
jmcs2 = a pseudonym of has
aning = a pseudonym of 
cantsin = a pseudonym of pseudonym
jmcs2 = a pseudonym of in
of = a pseudonym of pseudonym
meanings = a pseudonym of =
pseudonym = a pseudonym of several
in = a pseudonym of little
viel = a pseudonym of cantsin
means = a pseudonym of of
cantsin = a pseudonym of cantsin
a = a pseudonym of jmcs2
means = a pseudonym of is
cantsin = a pseudonym of me
meanings = a pseudonym of of
cantsin = a pseudonym of a
lo_y = a pseudonym of meaning
a = a pseudonym of meanings
curious = a pseudonym of of
means = a pseudonym of viel
lo_y = a pseudonym of cantsin


> > > ( " jmcs2 told me cantsin is a little curious " )
> >
> > " jmcs2 has no meaning
> > " told has meaning in the past
> > " me is aning
> > " cantsin has unendlich viel meanings
> > " is means
> > " a mens
> > " little means
> > " curious has several meanings
> >
> > " and lo_y is 
>
> cantsin = a pseudonym of lo_y
> lo_y   = a pseudonym of jmcs2
>
>
> cantsin






From: net_CALLBOY <play@ubermorgen.com>
Subject: Re:
Date: Wed, 13 Nov 2002 14:38:10 +0100

-- 

  HANS BERNHARD
  a.k.a. etoy.HANS, etoy.BRAINHARD, hans_extrem, e01

  HTTP://WWW.HANSBERNHARD.COM    2002
  HTTP://WWW.UBERMORGEN.COM      1999-2002
  HTTP://WWW.ETOY.COM            1994-1999
  HTTP://WWW.ETOY.AG             1999-2002







  uberDISCLAIMER _acctggggtggggcctggaaagggtctctggggg
  thecontentsofthisemail,andanyattachments,aregggggg
  CONFIDENTIALandintendedonlyfortheperson[s]togggggg
  whomtheyareaddressed::ifyouhavereceivedtheemgggggg
  ailinerror,pleasenotifythesenderimmediatelyagggggg
  nddeleteitfromyourcomputersystem::donotcopyogggggg
  rdistributeitordiscloseitscontentstoanypersggggggg
  n::unlessotherwisestated,theviewsandopinionsgggggg
  expressedinthisemailarepersonaltothesenderangggggg
  ddonotrepresenttheofficialviewofthecompanyplgggggg
  easenotethatubermorgenmonitorse-mailssentorrgggggg
  eceived::furthercommunicationwillsignifyyourgggggg
  consenttothis_________________________actctggggggg



Date: Tue, 12 Nov 2002 23:19:08 +0100
From: info@tonk.org
Subject: [shakeZkknut] I want the spirit of Syndicate to awaken ! - http://anart.no/~syndicate/KKnut/


------------=_1037139552-655-196


Psycho Pompus Print: fire - Rangers
name: FF00FF
mailto:info@tonk.org
http://tonk.org

and I whisper:

16462646
77777777
56565656
77777777
36463646
77777777
56565656
77777777


------------=_1037139552-655-196
Content-Disposition: inline; filename="message.footer"




From: Alan Sondheim <sondheim@panix.com>
Date: Tue, 12 Nov 2002 23:40:59 -0500 (EST)
Subject: .!




.!


.homosexual! .magick.sex! .politics.homosexuality! .politics.sex! .sex!
.sex.NOT! .sex.bestiality! .sex.bondage! -,-,,-,,-,-,-,-,,,,-,-,-,-,,,,,-
.sex.bondage.particle.physics! .sex.boredom! .sex.fetish.feet!
.sex.fetish.hair! .sex.homosexual! .sex.masturbation! .sex.motss!
-,,,-,-,-,,-,-,-,,,,,,, .sex.movies! .sex.pictures! .sex.pictures.d!
.sex.pictures.female! .sex.pictures.male! .sex.sounds! .sex.stories!
.sex.stories.d! .sex.wanted! .sex.wizards! .sexual.abuse.recovery!
.sexual.abuse.recovery.d! .sexy.bald.captains! .sex.fetish.orientals!
.sex.voyeurism! .sex.spanking! .sex.exhibitionism! -
.sex.bestiality.barney! .sex.bestiality.hamster.duct-tape!
.sex.fetish.watersports! -,,,,-,,,-, .sex.watersports!
.sex.fetish.diapers! .sex.fetish.fashion! .sex.services! .sex.strip-clubs!
.sex.intergen! .sex.femdom! .sex.telephone! .sex.fat!
.sex.fetish.startrek! .sex.magazines! .sex.erotica.marketplace!
.tv.tiny-toon.sex! .sex.nasal-hair! .sex.breast! -,-,,-,-,,-,,-,-,
.sex.pedophilia! - .sex.fetish.watersports! - .sex.bondage! -
.sex.pictures! - .sex.enemas! - .sex.anal! - .sex.bears! - .sex.voyeurism!
.sex.necrophilia! - .sexuality.spanking! -


===


 



From: pascale gustin <gustin.pascale@free.fr>
Subject: n-o-s-u-b-j-e-c-t3
Date: Sun, 10 Nov 2002 22:02:15 +0100

& qU
'
e
]]e
p(br)UIs-s
       -se être eNt[R].end-u
e[l] se-
           -u][eMEnt
parc e-qu
'e]]e''aura''tt'

c- E qu{able} I lui était >>N <
-------------------------->>E cess
--------------------------->R
-------------------------->>v '&Tr'

------------sa pr- opre  n.-C----------entre
-----------------------------ssité

&  sE-
           -u][eMent ce][a.
































From: + lo_y + <loy@myrealbox.com>
Subject: RE-format.format.format: Re:  rich foster  full triplex bomb damage assessme
Date: Sun, 10 Nov 2002 14:25:41 +0100 (CET)

( " slowly crawling through last weeks mail " )

2  Tab rnacl pas In tim  Omprovenwho  ay away w   n k e r G d S r ngt
    work     ed         g fearchi        c           AbNAD    Ns wh    t  
    H N  A A M car   e a dscla m u      h t e L R G T E d a m R F   A 5 B 
A    RE  R     M  v nt dsinsMose  v Si N  He se v               th      i  
o  s   xe   he  er  inH ddE  dO s   ve  ti n        M     H 7   e       r
   n     i   rdv  cup  in icat Jose h e   a h         8            f  a 
a    se    ri h wif   o s  su Fi in    a     a     t l   i i   r e   io
    rt es  ca s   ep r   o  e      h   o  h   s 0d    fet   opp   inst
    gel  fo ms v r  us s r   hto    o s d   m   f         r     s r    ot 
mo  sec  ts  e ea  A S   e d di   h s li   1   lt     n s n  g s c c  o t h 
se v s p o ise    CA      '  B  A M   3         K P p     nag hs A peris
 w F d e r ap epwil   on s Rel 1  LEG N'  m IN   G'T   STA  S'A'  RAH   'H
d   i     p e m lti   1   l as    i     ack w r   r Up  or    d o s L 
ss   er b A s or  in   D 6 Sau p        pl  s    e   dMe b   M S ah s
al        s Go o   r D  u as17   c N    u nu     e   tu nss e ay   il   Tuc 
e     u d R w r  R  ke 1   U h  N  ea t R N es e  os   w   or    r ba R   l s
ik  r t h   o 19 a    u i  ga  pos  t   p i s Elit  a       u  r         a 
 f Rig       ue   s etu       on   c iu  o   t or   ulu a i   n i c  s  
e   ro   1 sh r W o    aL    flam s      ag    t mu m      u     N  n e   
e  l ti  22 h e   oo  w l   a  g i s u   r d S m  b a a d   a w R T R   a c
P  3 si  if C     eaU  prep  ed     f arA  Rom   ny   p e sON E L    N    T   4
Al  Egy   n   ir   h Ar very e   h ol  Ut D   a s t u h  h  Thens oth 5 
 W  WR   S Sm  bra A   L VER   EA he  so L B I   T     M t   i S 6 T  OU H  LS
 s n e   anst Ll ck  w    e   c rd f Od g   i    u t   a    a2      fi  llg
   t o  h e  l ng   es     o r sh do n rit  se     t    i 2  o n h s   
   mth e o t  r ugh   i l  egn  n a    samA    am   y o  m 9     a   c    ' ro 
   h    o h s  g im om b o   s n      d  r e   b o   30  a  c m i te        
 e SEg p e' u e  d R        c N a c g'   a  c N        h SIn   r' ng  od S'
 s i l M S s d v'    eD  O'f p w p ac  i h 2     i s n'        rel i w i t   A
O   be   s   n a h   i R   o 3  si n      t can   t E   g h  se f   p or beg
n       Kn h  go A   3  d n m n y    ne  t   o A a a h  ea  e   h   e N
re  n  ls   i  er  5   e a e   l   E T l   i nrs  a   s i   T   O Es 
 f   w te  ee  ecau     o T Aw y P  PL  NS Sl  i gh     a N    t    o p 
wh reg M  ha    a      a l   a  pow  fu y  orm h o     Rr   O D  EVIL A 
 s  spei  i  A  38        NGEL  fi  w cke   pN   cel        EVIE  l   a yaw
   c t  eth3   A   LS   I n  s dos   e  o   ssi   H   o      J  ill g  MI 
 e s home     d          a   a ctU r stt sts      od        r    J WiL   o
ic ael   1   r   o   co  e poNd'   ilos sar   s   u t a   r   n i Dl'  o p
c  ver 4        o    ay N on Ay'  an'tn  har   l      s     e U is Ms't  k'o
   43  ad t        Uiti s se H stTho'sn  G  e c N         Ligh s ns G  Mich'l
4  A h     p  i h w fth  t l  W    eg d l          ad o t p iVy m  n 4   m a 
 n t  h s l   pw a on Am m t rs T k       od b d   i s lv   6   E A M       
 h ' w rd   ght  adian   ta  IMpul               el   d ma 47 l    Y   A S d 
    t E  pa sdl O     O   in T    ' d a      r   Hy 8  fen C N   U N  C 
 l a ' l h   g mu  r c n  RCT O     R    N   t m ' t 9   su j Ti i     
 N     C N    I   t s ' a     er e  t r r   T VES5  pro  R Y C s p o l s o hs  l
     h     RS N  s an w redwe l51   t limi      o         e r constru t o
te rs b     agai     e  2  o r p n ing for h   ad bada t  ough  n   m  r     
 t l t relati    3 will  d  iduals   MFO  T IES  carc  atedye   haraoh s
rc  hagu  t   54 in ing  o le   an n     pak sra li  swor  C   to 
re ons ru  I   YEA5   A  Pr g a l  nyth  me n  e  mean r p   E A  ON
       et s p i  stoo   p o  s st Thou n   OPY  OL G C   suc d w g n W t  
 s    n w57 hills E ALE  PA  ICU arly I rae u T o   so  l a t s fi  o  spr
a  Clo  58 dared  mon s T    Gsz  do   g id   e  menae   a    ainwat   ses
 g I 5  Cul  rE  de ced   s wid    D r   edreas  s ot    r v  Ion s E  u  60
a     h t  t T Go  ack a   e  wll co  U  y      ne  al u i o e s 
 r y 1 w l   o     ooed Gol E Wor h PEvr  hi g M s s o   d k n i y n e   a 62
sh t A A ek     mod   o m n s    P ti h r m e e s   e mo Ds co  U s63  empe
e   f e   o  aio  kee   t u t eg   on  A nin K   a   N bri  u y 4 l l   
sj Ke a   G G d e     i  E t s Tl m n  Olised g p   ou   urn  65 ro    in  e
     a  E i O Mi i m  O h    u i g y    o w   r  p     yp 6      n        
ee   vo T n    o i h R  i e t   t n i A  r s i   l e s1   h  mou  aI s D 
 i s Go  En e o     i hmet   ys      ee  t 
 
 
 
_______________________________________

__   -   -  lo_y  -  -   __  _
_______________________________________

PTRz: 
http://rhizome.org/object.rhiz?5852
http://trace.ntu.ac.uk/incubation/gallery.cfm
http://www.muse-apprentice-guild.com
http://www.krikri.be/poeuk.html
http://www.google.com/search?q=lo_y
http://lo-y.diaryland.com/
________________________________________


From: a u t u m n - f r e q u e n c y
Subject: Re: [Re: L+: sub-set -- B. draFFRAX/i/o/n.PATTeRRynst
Date: Sun, 10 Nov 2002 20:49:56 -0700

//*begiNNe n.tnt:
subsette vs subsette
ova rati/o: such ast:
subsette / subsette
oRRe in codaLange:
=3D=3D=3D=3D=3DXXX; <=3D=3D=3D
oRRe in fingPrest:
RE:sette vs RE:sette
oRRe in rklive true_nAIMeSTATes:
L+: vs. -- B.
oRRe in table.wav sent (f)ROM: autumn-frequency.lib: =

indentikit vs. idatafic(a)T/i/o/ns
oRRe in char.TO:graffic_paragraMMes:
ghlumechs vs. keyGens
oRRe in subLIM=3D_LoweRRe:
ngiNNe vs. PAT_REC.ogg_knit
oRRe in soc.tiCC.logs:
srcFree vs. baseBelong
oRRe in abbrevLLets: =

iLL vs. eRR
oRRe in x.10.x/i/o/ns:
istiCCaLLt vs. ent
:eNNette n.tnt*//
!THISLISETTEASTDIRECTTKTED10TO:02.KOM_INNeMEANTs(f)ROM:activPORTiCCipnts!=

<---//quoteSPC mem"OR"able dig.R#M.#em.sNs+craques iNNe DAT sueRRe.fax
=3Dsub.scribt:py_tnt_(a)wyning//-->  =

aLL com kno ment? kno arc.kno.l3dg3?
aLL klist kno func?? kno arc.kno.l3dg3MMeantte?
aLL iNNe kno ouTTpuTTe??? eRRenTTeFile(fix)?
goTo ver.aLL.citi + POST.x.crost-------------------->
sym.b.aLL.citiCC_aLL------------------------->< B R >
<---------------------[wit.K-ODE.SPC]--------------->
|MAKE_RE:Flx.v.mrkUp^on_Abv_cmd_K-Linear.knotes.knot|
<--------------------------------------------------->
\n.K-ODEs.k.\___________________K-Leane.ova.throat:TO
=2E\PT_seqrwets\__________________x.presetteSUB////////
=2E.\kleft.K-ODE\_________________iNNe.bN///////////
=2E..\m.bracksISH\________________blt//////////
=2E...\m.PRAXIshft\_______________TEST//
_____________________________________LIM
||||||||||||||||||||||||||||||||||||||nt
graffiCCaLLt.x.tru_nAIMeSPCs_RE:tyrn:TO:srcFld
fndSNDs.wav.ova.legacyK-ODEs(f)ROMusics_prntRLTN:$=3D"END.STRING"
(f)ROM.legacyModes.when.singK-ODEs
openThrownSHAPEmrkeRR+renderView_ovaVOX
ouTTPuTTe REC.s - CH. 0(n):
compLETTE~trks:pubt/post-digitaLL.med:
view.pnt oNNe:
"di.LOG"/"DUR.stnc"/"teLL.tar"/"get-mech-kollUM"/"func"/"tyrnist"/
Litt. phono :To choose freq_(a)
10. ()CrclSPC[keyyePressette] - timeBase=3DRE:myxt.x.fingCOUNT
(aLL.wyst.b04.=3D"PRE"calc(a)LooseTONE02(a)rm(a)"????")
[mem-(0b.)eRR-nAIMeSTATes=3D
"plain.txt"/"ASCII.char.settes"/"ova"/"flows"/"fluid"/"mini-(m)aLLisTTiCC=
aLL
vs.
maxi-(m)aLLisTTiCCaLL"/"iNNeDEX-oft-ordeRReLY-libs"/"aLL.wyst.BRs"/"aLL.w=
yst.rupts"/"LLEAKKes"
-m.beddePREdriFFTTeTO:forma.n.tnt]]]
||||||||||||||||||||||orn;(a)-meant?
=2E.../]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]
=2E../[[[[[[[[[[[[KHARUST.YR.K-ODES!]]
=2E./{{{{{{{{{{{{{B.WROTTE/B.ROQUETTE}
=2E/[[[[[[[[[[[[[[KRAST.YR.K-ODES.KOM]
/{{{{{{{{{{{{{{{PLEATTE]]]]]]]]]]]]]
<---RE:QWEST----------------------->
<---------------------------------------------->
|MAKE:TO:autumn-frequency//(a)NUM.b.eRRe_mrkUp^|
<---------------------------------------------->
||||||||(a)prov.(a).NUM_STATe_fixt_IDentikit||||
iNNe arte wyting ON K-LINES TO:
=B3k-lean=B2 wyst DAT "on" LY
para.meter.04.versiCCaLL/trans/litte/aLL/.mov/(m)/.ENT
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||=
||||||
kno.mov/(m)/.ENT_unTILL.(a)provt_calt-DAT-an-"OPEN.SYST"?
<---m.klist."IF".per.iLL.ist.iCC.aLL-------------------->
m.PULsent<--->"THEN"___"OPEN_komfrnt(a)x/i/o/n.aLL.ist.<--->m.port:MESTag=
e
_ayrrAY_oft_iNNe_oPIN_passwyrds+keySEQs_"YOU"_klimmering04nAIMsakes!
//!oPINe//kom//Line//12//12
*
craystiLL.n.fingsTaLL.kin.ova.deadHNDs
*
//kept_kliMMeRRing!
_STRayrrFABriCC(sp)LIT[te]_shoult_sub_SCR_iLL=3DsrcKIT.raw
--br.iLL.i.eNNTT.gliMMerFull.oft.dashes-------
----------------------------
++++++++++++++++++++++++++++------------------
=3DtransMITTeTRYLMEME0b.eRR.serial.SHIM.briLLayLL-OUT-touchScreeNNe.(a)gr=
ainstNTRY--->
----------->NFO.RE:QWEST<------------------------------------------------=
-----------
----------->_____vs.____<-----------R
----------->_____vs.____<-----------R.n
----------->_____vs.____<-----------R.n.mnt
----------->_____vs.____<-----------R.(v)eRR
----------->_____vs.____<-----------R.(s)eRR
-[iNN.trophyK-ODEs.iNNe.closette.SUBsettes.m.blt.m.bx]-
iNNeNUM.K-ODEs.kno.K-LINES.such.ast."IF".oft.eNNe."known".04.prop.GAYTEWA=
YTING.throughUNK-LSTclussTTeRRes.oft.mist.paqkettes_SENT:TO:techne:K-Odes=
:TO:arrive@K-Lineslaysting.ova.clearBINS.oft.restLESS."THEN".arriv.aLL.ab=
rev.st.(a)T.(a)LL_yst_ENTRYwy04aNOMiCCaLLnAIMSTATe.iNNe.pulsette.through.=
K-NONLIN_ova.cutDevices.culled.(f)ROM.arte
``````````````````````````````````````````````
```````````````````````````````````````````````.knet
"iLLustrayOUS"-"di.(a).LOGGiCCaLL"-"n.blndTones"+chromoHUEs.lange
=2E............iNNe.dist.URL:quoteSPC.dist.placette(f)ROM:
autumn-frequency



From: pascale gustin <gustin.pascale@free.fr>
Subject: (d-i-s-t-u-r-b-a-n-c-e)
Date: Tue, 12 Nov 2002 22:36:01 +0100

--------------------------->8:58-GMT<Gé-èMe-Té>

Le-s-S en][S
c
om.en mu-n(d)
           no(w)
---------->us<
            bt<

.g].[ui.l][d-era p][our no-------------------------[Where
---------------------[us aid./er
-----OPEN------------->.
à tr-ouv(rir)-er quelques pistes de ref(lect)
-------------------------------------[lex
---------------------------------------[ions
;

le fait également de traiter
ces questions conjointement pourra également

(car il ne peut s'agir que de cela pour le moment)

aider à ce que ces (question)nements parviennent à

s-é-c(enlighten)a-i-r-e[r-l][un-l][autre.]

------------>9:21-GMT<Gé-èMe-Té>
------------>9:22-GMT<Gé-èMe-Té>
------------>9:23-GMT<Gé-èMe-Té>
------------>9:24-GMT<Gé-èMe-Té>
------------>9:25-GMT<Gé-èMe-Té>
------------>9:26-GMT<Gé-èMe-Té>
------------>9:27-GMT<Gé-èMe-Té>
------------>9:28-GMT<Gé-èMe-Té>
------------>9:29-GMT<Gé-èMe-Té>
------------>9:30-GMT<Gé-èMe-Té>

------------>9:30-GMT<Gé-èMe-Té>
------------>9:30-GMT<Gé-èMe-Té>
------------>9:30-GMT<Gé-èMe-Té>
------------>9:30-GMT<Gé-èMe-Té>
------------>9:30-GMT<Gé-èMe-Té>






--------------------------Gé-----------------èMe-
------------------------------------------------->Té























From: "dis.[UR]Locate" <netwurker@hotkey.net.au>
Date: Sun, 10 Nov 2002 14:12:31 +1100
Subject: Re: Fwd: Re: RHIZOME_RAW: "digital we[ave]tting" vs

At 02:57 AM 10/11/2002 +0000, you wrote:
>if i'm not mistaken, mez here is proposing the works exist in a
>certain communicative channel...they're a flow of data////like all
>things really are////


_form from_

or even

_form form_


>my question would be (and the answer to this would actually help me
>distinguish between works): where does the data come from? where does
>it flow to?

_net.wurks_ u.se[e] information.

<d.fine: information?>

_in form_


>one can say (as in romanticism): well, the data comes from somewhere
>up there: it flows into me, and then out:::::all of which is true////
>

up there: no
in2: no
out: no

[a trip.tick.ler of nos].
[think no.dic[k]|x.plosive, la[la laaaa li]terally.]

>but the works i like best are those in which data comes from several
>sources (not simply repsawning my own): data comes from you, and you,
>and you, and you, and you=====and goes to you and you and you and
>you////

u & u & u.

[ewes & use = cul.pa[lata]ble comprehension].

>this is interesting to me because it's pointing to an epitemology of
>net art (or at least an epistemology of mez's work, which interests
>me greatly)////
>
>but i still don't understand why they're not texts? how would you
>define a text, mez? and what is the distinction between that and what
>you do?

i _net.wurk_.

[u text b.coz u r].
[i net.wurk b.coz i am
w.here.].
[u purr.[d]sist in b.ing .here.]

oppositional here|w.here.






. . .... .....
pro][tean][.lapsing.txt
.
.
www.cddc.vt.edu/host/netwurker/
http://www.hotkey.net.au/~netwurker/
http://www.hotkey.net.au/~netwurker/display.myopia.swf

.... . .??? .......


 



From: "dis.[UR]Locate" <netwurker@hotkey.net.au>
Date: Sun, 10 Nov 2002 13:41:45 +1100
Subject: Re: Fwd: Re: RHIZOME_RAW: "digital

At 02:28 AM 10/11/2002 +0000, you wrote:
>are your texts using other texts?

they r not texts.

  "texts" respawn yr own.

>  how is the network important to
>these texts?

"texts" *r* not the net.work.
"t4e0x4ts" Not Found.
_net.wurks_ *r* the net.work.

_texts_ plug the gaps + _net.wurks_manifest as form from packet-driven 
con.tent.

_form from_
_homogenesis substrata b.coming a.n][et][atomy_

think _code_ ][trans][forming ][2][ _application_.

text does not exist w.here.



. . .... .....
pro][tean][.lapsing.txt
.
.
www.cddc.vt.edu/host/netwurker/
http://www.hotkey.net.au/~netwurker/
http://www.hotkey.net.au/~netwurker/display.myopia.swf

.... . .??? .......


 





nettime unstable digest vol 21
Sun Nov 17 14:06:08 2002


Subject: Stephen & Marian Guei
    From: Jeffrey Jullich <jeffreyjullich@YAHOO.COM>

Subject: everyone
    From: Alan Sondheim <sondheim@PANIX.COM>

Subject: Re: RE: |   || " || 10-11-2002-13:36 |_| 245516 4"
    From: "+   lo_y.  +" <loy@myrealbox.com>

Subject: Re: REnewed: ||   || " || 10-11-2002-13:36 |_| 245516 4" || red|||||blue||||||yellow||||||yellow|||||white||||||      | 'red ~" || - |
    From: "Johan Meskens CS2 jmcs2" <JohanMeskensCS2@chromaticspaceandworld.com>

Subject: Re:
    From: net_CALLBOY <play@ubermorgen.com>

Subject: [shakeZkknut] I want the spirit of Syndicate to awaken ! - http://anart.no/~syndicate/KKnut/
    From: info@tonk.org

Subject: .!
    From: Alan Sondheim <sondheim@panix.com>

Subject: n-o-s-u-b-j-e-c-t3
    From: pascale gustin <gustin.pascale@free.fr>

Subject: RE-format.format.format: Re:  rich foster  full triplex bomb damage assessme
    From: + lo_y + <loy@myrealbox.com>

Subject: Re: [Re: L+: sub-set -- B. draFFRAX/i/o/n.PATTeRRynst
    From: a u t u m n - f r e q u e n c y

Subject: (d-i-s-t-u-r-b-a-n-c-e)
    From: pascale gustin <gustin.pascale@free.fr>

Subject: Re: Fwd: Re: RHIZOME_RAW: "digital we[ave]tting" vs
    From: "dis.[UR]Locate" <netwurker@hotkey.net.au>

Subject: Re: Fwd: Re: RHIZOME_RAW: "digital
    From: "dis.[UR]Locate" <netwurker@hotkey.net.au>



lurking editors

beatrice beaubien <i2eye@mac.com>
    7-11 nettime-bold syndicate thingist 
florian cramer <cantsin@zedat.fu-berlin.de>
    7-11 _arc.hive_ eu-gene o-o rhizome rohrpost syndicate webartery wryting 
alan sondheim <sondheim@panix.com>
    7-11 _arc.hive_ poetics siratori trAce webartery wryting 
$Id: digestunstable.pl,v 1.11 2002/10/09 17:22:50 paragram Exp $

#  distributed via <nettime>: no commercial use without permission
#  <nettime> is a moderated mailing list for net criticism,
#  collaborative text filtering and cultural politics of the nets
#  more info: majordomo@bbs.thing.net and "info nettime-l" in the msg body
#  archive: http://www.nettime.org contact: nettime@bbs.thing.net